Primer list:

Name Length Oligo Squence
3'AOX 21 GCAAATGGCATTCTGACATCC
3'DNA-BD 24 TAAGAGTCACTTTAAAATTTGTAT
3'AD 20 AGATGGTGCACGATGCACAG
5'AOX 21 GACTGGTTCCAATTGACAAGC
ACGFP1-R 20 GGTGGTGCAGATGAACTTCA
ACYCDuetUp1 19 GGATCTCGACGCTCTCCCT
ADH1-TTR 22 GTAAATTTCTGGCAAGGTAGAC
AS S¡ETag 18 18 GTCCATGTGCTGGCGTTC
BAD-F 23 GCTATGCCATAGCATTTTTATCC
BAD-R 25 GCGTTCTGATTTAATCTGTATCAGG
BGH-R 18 TAGAAGGCACAGTCGAGG
CL3 23 GTTGATTGCAGTCCAGTTACGCT
CMV-F 20 ATGGGAGTTTGTTTTGGCAC
CMV24 21 AGGCTGGTGGGCACTGGAGTG
CMVbeta-R 20 CAGACCAATGCCTCCCAGAC
CMV-IE 18 TGTACGGTGGGAGGAGGTCTA
ColiDOWN 21 TTCACTTCTGAGTTCGGCATG
DsRed-1211F 20 ACATCACCAACCACAACGAG
DsRed1-C 24 AGCTGGACATCACCTCCCACAACG
DsRed1-N 21 GTACTGGAACTGGGGGGACAG
DuetDown1 20 GATTATGCGGCCGTGTACAA
DuetUp2 20 TTGTACACGGCCGCATAATC
EGFP-3957F 20 TATAGTCCTGTCGGGTTTCG
EGFP-C 22 CATGGTCCTGCTGGAGTTCGTG
EGFP-CR 21 CAAACCACAACTAGAATGCAG
EGFP-N 22 CGTCGCCGTCCAGCTCGACCAG
GAL1 24 AATATACCTCTATACTTTAACGTC
GAL4-ADF 21 TATAACGCGTTTGGAATCACT
GFP reverse 22 GCTACATACGGAAAGCTTACCC
GL1 24 TGTATCTTATGGTACTGTAACTG
GL2 21 CTTTATGTTTTTGGCGTCTTCC
HcRed1-1185F 22 CTTCCACTTCACCGACATCC
KAN-2 FP-1 25 ACCTACAACAAAGCTCTCATCAACC
KAN-2 RP-1 25 GCAATGTAACATCAGAGATTTTGAG
LKO-shRNA-R 19 CTGTTGCTATTATGTCTAC
M13F 18 TGTAAAACGACGGCCAGT
M13F(-40) 17 GTTTTCCCAGTCACGAC
M13R 18 ACAGGAAACAGCTATGAC
malE 24 GGTCGTCAGACTGTCGATGAAGCC
Mxe InteinR 18 GGCACGATGTAGGCGATG
N-CMV30 20 AATGTCGTAATAACCCCGCC
OplE2 Forward 20 CGCAACGATCTGGTAAACAC
PACT-F 22 CGAACCTCATAACAACTCAAAC
PBAD-myc-his-241F 22 ATCCTACCTGACGCTTTTTATC
pCMV 27 GATCCGGTACTAGAGGAACTGAAAAAC
pCMV-GIN-ZEO-F 20 CCGCTGTTTGAATGAGGCTT
pCMV-HA-R 21 CCCTGAACCTGAAACATAAAA
pDNR-M13R 20 CGAGGGAAACAGCTATGACC
pET Upstream 16 ATGCGTCCGGCGTAGA
pGEX3' 23 CCGGGAGCTGCATGTGTCAGAGG
pGEX5' 23 GGGCTGGCAAGCCACGTTTGGTG
PLKO.1-seg 20 CTATTCTTTCCCCTGCACTG
pMIR5' 18 AGGCGATTAAGTTGGGTA
PNRK-R 19 GCTCGAAAACAGCTATGAC
PNRK-R880 22 CAAATAAAGCAATAGCATCACA
polyhedron F 20 AAATGATAACCATCTCGCAA
pQEF 22 GGCGTATCACGAGGCCCTTTCG
pQER 22 CATTACTGGATCTATCAACAGG
pRSET reverse 21 CTAGTTATTGCTCAGCGGTGG
pSE380F 20 AATCATCCGGCTCGTATAAT
pTrcHis forward 21 GAGGTATATATTAATGTATCG
pTrcHis reverse 18 GATTTAATCTGTATCAGG
RV3 20 CTAGCAAAATAGGCTGTCCC
RV4 20 GACGATAGTCATGCCCCGCG
S-DsbC-Tag 17 GAATTTCTCGACGAACA
S-tag 17 GAACGCCAGCACATGGACAGC
S-Tag-18 18 GAACGCCAGCACATGGAC
SP6 18 ATTTAGGTGACACTATAG
SR2 26 GGTCAGGTATGATTTAAATGGTCAGT
T3 Promoter 20 ATTAACCCTCACTAAAGGGA
T7 Promoter Primer(T7-20) 20 TAATACGACTCACTATAGGG
T7 terminator 19 GCTAGTTATTGCTCAGCGG
T7-18 18 TAATACGACTCACTATAG
T7-reverse 21 CTAGTTATTGCTCAACGGTGG
TA-F 20 CAAGGCGATTAAGTTGGGTA
TA-R 20 GGAATTGTGAGCGGATAACA
Trx-F 18 TTCCTCGACGCTAACCTG
Trx-R 20 TGTAAAACGACGGCCAGTGC
TrxFus forward 18 TTCCTCGACGCTAACCTG
U6 promoter 19 TACAAAATACGTGACGTAG
V5(C-term)reverse 20 ACCGAGGAGAGGGTTAGGGA
Xpress Forward 19 TATGGCTAGCATGACTGGT
α-factor 18 TATTGCCAGCATTGCTGC
XL39 20 ATTAGGACAAGGCTGGTGGG
VP1.5 20 GGACTTTCCAAAATGTCG
ITS4 20 TCCTCCGCTTATTg
ITS1 19 TCCGTAGGTGAACCTGCGG
ITS5 22 GGAAGTAAAAGTCGTAACAAGG
27F 20 AGAGTTTGATCMTGGCTCAG
1492R 22 TACGGYTACCTTGTTACGACTT
530F 16 GTGCCAGCMGCCGCGG
805R 20 GACTACCAGGGTATCTAATC












Nanopore















Small Genome Resequencing



Small Genome De Novo Sequencing



Exome



Epigenome



Metagenome



Transcriptome






RNA-Seq



De Novo RNA-Seq



Small RNA














  • TA Cloning
  • Restrict Enzyme Cloning